Tiêu chuẩn Quốc gia TCVN 8400-34:2015 Bệnh động vật-Quy trình chẩn đoán-Phần 34: Bệnh biên trùng ở trâu bò

Thuộc tính Nội dung Tiêu chuẩn liên quan Lược đồ Tải về
LuatVietnam.vn độc quyền cung cấp bản dịch chính thống Công báo tiếng Anh của Thông Tấn Xã Việt Nam

TIÊU CHUẨN QUỐC GIA

TCVN 8400-34:2015

BỆNH ĐỘNG VẬT - QUY TRÌNH CHẨN ĐOÁN - PHẦN 34: BỆNH BIÊN TRÙNG Ở TRÂU BÒ

Animal diseases - Diagnostic procedure - Part 34: Bovine anaplasmosis

Lời nói đầu

TCVN 8400-34 : 2015 được xây dựng trên cơ sở tham khảo OIE (2012), Manual of diagnostic tests and vaccines for terrestrial animals, Chapter 2.4.1 Bovine Anaplasmosis;

TCVN 8400-34 : 2015 do Trung tâm Chn đoán Thú y Trung ương - Cục Thú y biên soạn, Bộ Nông nghiệp và Phát triển nông thôn đề nghị, Tổng cục Tiêu chuẩn Đo lường Chất lượng thm định, Bộ Khoa học và Công nghệ công bố.

Bộ tiêu chuẩn TCVN 8400 Bệnh động vật - Quy trình chẩn đoán gồm 38 phần:

- TCVN 8400-1 : 2010, phần 1: Bệnh l mồm long móng;

- TCVN 8400-2 : 2010, phần 2: Bệnh do vi khuẩn Streptococcus suis gây ra trên lợn;

- TCVN 8400-3 : 2010, phần 3: Bệnh giun xoắn;

- TCVN 8400-4 : 2010, phần 4: Bệnh Niu Cát Xơn;

- TCVN 8400-5 : 2011, phần 5: Bệnh tiên mao trùng;

- TCVN 8400-6 : 2011, phần 6: Bệnh xuất huyết thỏ;

- TCVN 8400-7 : 2011, phần 7: Bệnh đậu cừu và đậu dê;

- TCVN 8400-8 : 2011, phần 8: Bệnh nấm phổi do Aspergillus ở gia cầm;

- TCVN 8400-9 : 2011, phần 9: Bệnh viêm gan vịt type I;

- TCVN 8400-10 : 2011, phần 10: Bệnh lao bò;

- TCVN 8400-11 : 2011, phần 11: Bệnh dịch tả vịt;

- TCVN 8400-12 : 2011, phần 12: Bệnh bạch lị và thương hàn ở gà;

- TCVN 8400-13 : 2011, phần 13: Bệnh sy thai truyền nhiễm do brucela;

- TCVN 8400-14 : 2011, phần 14: Bệnh tụ huyết trùng ở trâu bò;

- TCVN 8400-15 : 2011, phần 15: Bệnh xoắn khuẩn do Leptospira;

- TCVN 8400-16 : 2011, phần 16: Bệnh phù ở lợn do vi khuẩn E.coli;

- TCVN 8400-17 : 2011, phần 17: Bệnh do vi khuẩn staphylococcus aureus gây ra ở gà;

- TCVN 8400-18 : 2014, phần 18: Bệnh phù đầu gà (coryza);

- TCVN 8400-19 : 2014, phần 19: Bệnh phó thương hàn lợn;

- TCVN 8400-20 : 2014, phn 20: Bệnh đóng dấu lợn;

- TCVN 8400-21 : 2014, phần 21: Hội chứng rối loạn sinh sản và hô hp ở lợn (PRRS);

- TCVN 8400-22 : 2014, phần 22: Bệnh giả dại ở lợn;

- TCVN 8400-23 : 2014, phần 23: Bệnh ung khí thán;

- TCVN 8400-24 : 2014, phần 24: Bệnh viêm phế quản truyền nhiễm;

- TCVN 8400-25 : 2014, phần 25: Bệnh cúm lợn;

- TCVN 8400-26 : 2014, phần 26: Bệnh cúm gia cầm H5N1;

- TCVN 8400-27 : 2014, phần 27: Bệnh Sán lá gan;

- TCVN 8400-28 : 2014, phần 28: Bệnh viêm ruột hoại tử do vi khuẩn Clostridium perfringens;

- TCVN 8400-29 : 2015, phần 29: Bệnh Lympho leuko ở gà;

- TCVN 8400-30 : 2015, phần 30: Bệnh Marek ở gà;

- TCVN 8400-31 : 2015, phần 31: Bệnh Tụ huyết trùng gia cầm;

- TCVN 8400-32 : 2015, phần 32: Bệnh Gumboro ở gia cầm;

- TCVN 8400-33 : 2015, phần 33: Bệnh Lê dạng trùng ở trâu bò;

- TCVN 8400-34 : 2015, phần 34: Bệnh Biên trùng ở trâu bò;

- TCVN 8400-35 : 2015, phần 35: Bệnh Theileria ở trâu bò;

- TCVN 8400-36 : 2015, phần 36 : Hội chứng suy mòn ở lợn sau cai sữa do Circo virus typ 2;

- TCVN 8400-37 : 2015, phần 37: Bệnh viêm phổi địa phương lợn;

- TCVN 8400-38 : 2015, phần 38: Bệnh tiêu chảy ở lợn do Corona virus.

 

BỆNH ĐỘNG VẬT - QUY TRÌNH CHẨN ĐOÁN - PHẦN 34: BỆNH BIÊN TRÙNG Ở TRÂU BÒ

Animal diseases - Diagnostic procedure - Part 34: Bovine anaplasmosis

CNH BÁO - Việc áp dụng tiêu chun này có thể liên quan đến các vật liệu, thiết bị và các thao tác gây nguy hiểm. Tiêu chuẩn này không thể đưa ra được hết tất cả các vấn đề an toàn liên quan đến việc sử dụng chúng. Người sử dụng tiêu chuẩn này phải tự thiết lập các thao tác an toàn sức khỏe thích hợp và xác định khả năng áp dụng các giới hạn quy định trước khi sử dụng tiêu chun.

1. Phạm vi áp dụng

Tiêu chuẩn này quy định quy trình chẩn đoán bệnh biên trùng ở trâu bò do một số loài Anaplasma spp. gây ra.

Tiêu chuẩn này cũng có thể áp dụng để chn đoán bệnh biên trùng cho các gia súc khác như dê, cừu, hươu nai, lạc đà.

2. Thuật ngữ và định nghĩa

Trong tiêu chuẩn này sử dụng thuật ngữ và định nghĩa sau:

2.1. Bệnh biên trùng (Anaplasmosis)

Bệnh do một số loài đơn bào Anaplasma spp. như Anaplasma marginale, Anaplasma central, Anaplasma phagocytophilum... ký sinh trong hồng cầu gây ra.

CHÚ THÍCH: Khi con vật mắc bệnh, có biểu hiện đặc trưng như thiếu máu và vàng da. Mầm bệnh được truyền từ con vật bệnh sang con vật khỏe qua một số loài ve như Boophilus spp., Dermacentor spp...

3. Thuốc thử và vật liệu thử

Ch sử dụng thuốc thử loại tinh khiết phân tích, sử dụng nước cất, nước khử khoáng hoặc nước có độ tinh khiết tương đương, trừ khi có quy định khác.

3.1. Nguyên liệu và vật liệu th dùng cho phương pháp nhuộm Giemsa

3.1.1. Dung dịch muối đệm phosphat (PBS), 0,01 M, pH 7,0 (xem A.1).

3.1.2. Dung dịch Giemsa, 10 % (xem A.2).

3.1.3. Metanol tuyệt đối

3.2. Nguyên liệu và vật liệu thử dùng cho phương pháp realtime PCR

3.2.1. Kít tách chiết ADN (axit deoxyribonucleic), dùng cho mẫu máu chống đông (xem Phụ lục B).

3.2.2. Kít nhân gen.

3.2.3. Cặp mồi (primers) và mẫu dò.

3.2.4. Nước tinh khiết, không có nuclease.

3.2.5. Etanol, từ 96 % đến 100 % (thể tích).

3.2.6. Dung dịch đệm TE (Tris-axit etylendiamintetraaxetic).

3.3. Nguyên liệu và vật liệu thử dùng cho phương pháp ELISA (phép thử miễn dịch liên kết enzym)

Hiện nay các kít ELISA thương mại có sẵn trên thị trường dùng để phát hiện kháng thể biên trùng. Khi sử dụng phương pháp ELISA cần theo đúng hướng dẫn của nhà sản xut.

4. Thiết bị, dụng cụ

Sử dụng thiết bị, dụng cụ thông thường của phòng thí nghiệm sinh học và những thiết bị, dụng cụ sau:

4.1. Thiết bị, dụng cụ sử dụng chung

4.1.1. Tủ lạnh âm sâu, có thể duy trì nhiệt độ từ âm 20 °C đến âm 80 °C.

4.1.2. T lạnh, có thể duy trì nhiệt độ 2 °C đến 8 °C.

4.1.3. Máy lắc trộn vortex.

4.2. Thiết bị, dụng cụ dùng cho phương pháp nhuộm Giemsa

4.2.1. Phiến kính, vô trùng.

4.2.2. Lamen, vô trùng.

4.2.3. Kính hiển vi quang học, vật kính dầu 100 X.

4.3. Thiết bị, dụng cụ dùng cho phương pháp realtime PCR

4.3.1. Máy ly tâm, có thể ly tâm với gia tốc 6 000 g và 20 000 g.

4.3.2. Máy nhân gen (realtime PCR).

4.3.3. Máy spindown, có thể ly tâm với gia tốc 6 000 g.

4.4. Thiết bị, dụng cụ dùng cho phương pháp ELISA

4.4.1. Tủ ấm, có thể duy trì nhiệt độ ở 37 °C.

4.4.2. Máy đọc ELISA, có thể đọc ở bước sóng 405 nm.

4.5. Máy lắc dùng cho phương pháp CAT (phản ứng ngưng kết trên bản nhựa)

Có thể hoạt động với tốc độ từ 100 rpm/min đến 110 rpm/min.

5. Chẩn đoán lâm sàng

5.1. Đặc điểm dịch tễ

- Mầm bệnh Anaplasma spp. được truyền từ con vật bệnh sang con vật khỏe qua một số loài ve như Boophilus spp., Dermacentor spp., Ixodes spp…, các loài mòng họ Tabanidae, một số loài muỗi cũng có thể truyền cơ giới bệnh biên trùng;

- Bệnh biên trùng thường gặp ở trâu bò vùng có khí hậu nóng m. Loài gây bệnh chủ yếu ở vùng nhiệt đới là loài Anaplasma marginale;

- Bệnh thường lây lan mạnh vào mùa hè thu (từ tháng 6 đến tháng 10) khi ve phát trin mạnh.

5.2. Triệu chứng lâm sàng

5.2.1. Thể cấp tính

- Trâu bò sốt cao (từ 40 °C đến 41 °C), sốt cách quãng, hàng tháng mi phát một cơn sốt;

- Triệu chứng thiếu máu cấp tính xuất hiện dẫn đến con vật có thể chết;

- Triệu chứng thần kinh;

- Nước tiểu vàng không có huyết sắc tố (đây là đặc điểm phân biệt với bệnh lê dạng trùng);

- Tỷ lệ trâu bò chết tới 95 %.

5.2.2. Thể mạn tính

- Trâu bò gầy, lông xơ xác;

- Niêm mạc nhợt nhạt;

- Vàng da.

5.3. Bệnh tích

- Lách sưng, gan màu vàng nhạt, thận có màu nhạt;

- Não có những chấm xuất huyết;

- Tủy xương đông lại có màu vàng nhạt;

- Máu khó đông nhưng màu vẫn đỏ tươi.

5.4. Chẩn đoán phân biệt

Con vật nhiễm bệnh biên trùng có nước tiểu vàng không có huyết sắc tố; bệnh lê dạng trùng: nước tiểu có lẫn máu, màu đỏ.

6. Chẩn đoán trong phòng thí nghiệm

6.1. Phương pháp nhuộm Giemsa kiểm tra hình thái biên trùng

6.1.1. Lấy mẫu

Dùng xylanh 5 ml và kim tiêm 20 G (hoặc 18 G) vô trùng, lấy từ 1,5 ml đến 2 ml máu ở tĩnh mạch cổ hoặc động mạch đuôi của trâu bò nghi ngờ bệnh cho vào ống có chất chống đông (EDTA, natri xitrat hoặc heparin), ghi ký hiệu mẫu lên thành ống.

CHÚ THÍCH: Đồng thời kèm theo Phiếu gửi bệnh phm ghi rõ yêu cầu xét nghiệm và những thông tin về dịch tễ, các biểu hiện triệu chng, bệnh tích của bệnh.

6.1.2. Bo quản mẫu

Tất cả các mẫu bệnh phẩm đều được bảo quản trong thùng lạnh (nhiệt độ từ 2 °C đến 8 °C) chuyển đến phòng thí nghiệm trong vòng 48 h. Trong trường hợp chưa xét nghiệm ngay, mẫu máu chống đông cần bảo quản trong tủ lạnh (4.1.2).

6.1.3. Chuẩn bị mẫu

Mu bệnh phm là mẫu máu (6.1.1)

6.1.4. Cách tiến hành

6.1.4.1. Chuẩn bị tiêu bản

- Nhỏ một giọt máu (6.1.1) (tương đương 5 ml đến 10 ml) lên một đầu của phiến kính (4.2.1);

- Dàn mỏng giọt máu bằng lamen (4.2.2) hoặc một phiến kính khác (4.2.1);

- Tiêu bản để khô tự nhiên sau đó cố định bằng metanol tuyệt đối (3.1.3) trong 1 min. Để khô.

6.1.4.2. Nhuộm tiêu bn

- Đặt tiêu bản (6.1.4.1) vào cốc đựng dung dịch giemsa 10 % (xem A.2) trong 30 min;

- Rửa tiêu bản dưới vòi nước chảy từ 3 lần đến 4 lần;

- Để khô tiêu bản ở nhiệt độ phòng.

6.1.5. Xem hình thái biên trùng

Nhỏ một giọt dầu vào tiêu bản (6.1.5) và xem bằng kính hiển vi quang học (4.2.3), quan sát được hình thái biên trùng có hình dấu chấm, màu xanh đậm, và mang đặc điểm riêng cho từng loài như sau:

- A. central: có đường kính từ 0,3 mm nằm ở giữa hồng cầu;

- A. marginale: có kích thước 1 mm, nằm rìa hồng cầu.

6.2. Phương pháp realtime PCR phát hiện kháng nguyên biên trùng

6.2.1. Lấy mẫu

Xem 6.1.1.

6.2.2. Bảo quản mẫu

Xem 6.1.2.

6.2.3. Chuẩn bị mẫu

Xem 6.1.3.

6.2.4. Cách tiến hành

6.2.4.1. Tách chiết ADN

Sử dụng bộ kít tách chiết (3.2.1) thích hợp và an toàn theo hướng dẫn của nhà sản xuất.

DỤ: dùng kít tách chiết DNeasy® Blood & Tissue Kit (250) (Cat No. 69506)1) (xem Phụ lục B).

6.2.4.2. Chuẩn bị mồi và mẫu dò

Phản ứng khuếch đại được thực hiện trong máy nhân gen (4.3.2) theo phương pháp realtime PCR khuếch đại đoạn gen đặc hiệu Msp1b của A. marginale sử dụng cặp mồi, mẫu dò (3.2.3) được nêu trong Bảng 1.

Bng 1 - Trình tự cặp mồi và mu dò [1]

Gen đích

Mồi

Trình tự 5’-3’

Msp1b

Mồi xuôi (forward primer)

TTGGCAAGGCAGCAGCTT

Mồi ngược (reverse primer)

TTCCGCGAGCATGTGCAT

Mu dò

6 FAM - TCGGTCTAACATCTCCAGGCTTTCAT - BHQ1

Mồi và mẫu dò được chun bị như sau:

- Chuẩn bị mồi gốc và mẫu dò gốc: mồi và mẫu dò ở trạng thái đông khô phải được ly tâm nhanh bằng máy spindown (4.3.3) ở gia tốc 6 000 g trong 30 s để mồi và mẫu dò lắng xuống đáy ống trước khi m và hoàn nguyên. Lần đầu tiên nên dùng dung dịch đệm TE (3.2.6) để hoàn nguyên mồi, mẫu dò ở nồng độ 100 mM làm mồi gốc và mẫu dò gốc;

- Chuẩn bị mồi sử dụng ở nồng độ 20 mM, pha loãng mồi gốc bằng nước (3.2.4) (20 ml mồi gốc và 80 ml nước);

- Chuẩn bị mẫu dò sử dụng ở nồng độ 10 mM, pha loãng mẫu dò gốc bng nước (3.2.4) (10 ml mẫu dò gốc và 90 ml nước).

6.2.4.3. Tiến hành phản ứng

Sử dụng cặp mồi và mẫu dò đã được chuẩn bị (6.2.4.2).

Sử dụng kít nhân gen (3.2.2) theo hướng dẫn của nhà sản xuất.

VÍ DỤ: dùng kít nhân gen của QuantiTect Probe PCR, Qiagen (Cat No. 204341) 2)

Thành phần cho một phản ứng được nêu trong Bảng 2.

Bảng 2 - Thành phần phản ứng realtime PCR

Thành phần

Thể tích

ml

QuantiTect Probe PCR master mix

12

Mồi xuôi, 20 mM

1

Mồi ngược, 20 mM

1

Mẫu dò, 10 mM

0,5

Nước tinh khiết không có nuclease

5,5

Tổng thể tích

20

 

Chuyển 20 ml hỗn hợp nhân gen vào mỗi ống phản ứng:

- Mu kiểm chứng dương: cho 5 ml mẫu ADN có giá trị chu kì ngưỡng (Ct) đã biết trước vào ống phản ứng;

- Mẫu kiểm chứng âm: cho 5 ml nước (3.2.4) vào ống phản ứng;

- Mẫu bệnh phẩm: cho 5 ml mẫu ADN bệnh phm (6.2.4.1) vào ống phản ứng.

CHÚ THÍCH:

- Phản ứng realtime PCR phải bao gồm: mẫu bệnh phm, mẫu kiểm chứng dương và mẫu kiểm chng âm;

- Mu và nguyên liệu cho phản ứng Realtime PCR cn đặt trong khay đá lạnh trong suốt quá trình chun bị hỗn hợp phản ứng.

Tiến hành phản ứng Realtime PCR bằng máy nhân gen (Realtime PCR) (4.3.2) đã được cài đặt chu trình nhiệt được nêu trong Bảng 3.

Bng 3 - Chu trình nhiệt của phn ứng realtime PCR

Nhiệt độ

Thời gian

Số chu kỳ

95 °C

10 min

1

95 °C

45 s

45

60 °C

1 min

 

6.2.5. Đọc kết quả

Đọc kết quả bằng máy nhân gen (realtime PCR) (4.3.2) dựa trên giá trị Ct (Ct là thời điểm máy đọc realtime PCR ghi nhận tín hiệu huỳnh quang phát ra từ ống phản ứng bắt đầu vượt qua cường độ huỳnh quang nền);

Điều kiện phản ứng được công nhận: mẫu kiểm chứng dương tính có giá trị Ct biết trước, mẫu kiểm chứng âm tính không có Ct;

Với điều kiện như trên, mẫu có giá trị Ct 35 được coi là dương tính; mẫu không có Ct được coi là âm tính; mẫu có giá trị 35 Ct 40 được coi là nghi ngờ;

Những mẫu nghi ngờ cần được thực hiện lại quy trình xét nghiệm hoặc xét nghiệm bằng phương pháp khác để khẳng định.

6.3. Phương pháp ELISA phát hiện kháng thể biên trùng

6.3.1. Lấy mẫu

Sử dụng xylanh 5 ml và kim tiêm 20G (hoặc 18G) vô trùng, lấy từ 1,5 ml đến 2 ml máu ở tĩnh mạch cổ hoặc động mạch đuôi của trâu bò nghi mắc bệnh biên trùng. Sau khi ly, rút pittong lùi ra để tạo khoảng trống (hoặc bơm máu vào ống nghiệm vô trùng), ghi ký hiệu mẫu trên xylanh hoặc ống nghiệm rồi đặt nằm nghiêng 45° trong hộp đựng mẫu, để đông máu trong 1 h đến 2 h ở nhiệt độ bình thường, tránh ánh nắng trực tiếp.

6.3.2. Bảo quản mẫu

Tất cả các mẫu bệnh phẩm đều được bảo quản trong thùng lạnh (nhiệt độ từ 2 °C đến 8 °C) chuyển đến phòng thí nghiệm trong vòng 48 h. Trong trường hợp chưa xét nghiệm ngay, mẫu huyết thanh phải được ly tâm, chắt lấy phần huyết thanh sang ống khác, bo quản trong tủ lạnh âm sâu (4.1.1).

6.3.3. Chuẩn bị mẫu

Chắt huyết thanh từ xylanh (6.3.1) sang ống nghiệm vô trùng, kể từ lúc lấy máu đến lúc chắt huyết thanh không quá 24 h, ghi ký hiệu của mẫu lên ống chứa huyết thanh.

6.3.4. Cách tiến hành

DỤ: dùng bộ kít phát hiện kháng thể biên trùng ở trâu bò của hãng SVANOVA3).

6.3.4.1. Chuẩn bị nguyên liệu

- Dung dịch đệm: pha loãng PBS-Tween 20 X với nước cất theo t lệ 1/20 (cho 25 ml dung dịch PBS-Tween 20 X vào 475 ml nước cất), lắc đều. Bảo quản dung dịch đệm ở nhiệt độ t 4 °C đến 8 °C;

- Dung dịch kháng kháng thể bò: pha loãng kháng kháng thể bò với 11,5 ml dung dịch đệm (pha xong dùng ngay). Sau khi pha loãng bảo quản ở nhiệt độ âm 20 °C. Dung dịch kháng kháng thể bò đông tan tối đa 3 lần;

- Pha loãng mẫu kiểm chứng (âm, dương) và mẫu bệnh phm (6.3.3) với dung dịch đệm theo t lệ 1/40 (cho 10 ml mẫu kiểm chứng hoặc mu bệnh phm vào 390 ml dung dịch đệm).

6.3.4.2. Tiến hành phản ứng

- Các thuốc thử để ở nhiệt độ phòng từ 18 °C đến 25 °C trước khi sử dụng;

- Nhỏ 100 ml mẫu kiểm chứng (âm, dương) đã pha loãng (6.3.4.1) vào các giếng được chọn (mỗi mẫu thực hiện trên 2 giếng, vị trí của mẫu kiểm chứng đã được đánh du trong đĩa);

- Nhỏ 100 ml mẫu bệnh phẩm đã pha loãng (6.3.4.1) vào giếng được chọn (mỗi mẫu có thể làm 1 giếng hoặc 2 giếng, tuy nhiên trong trường hợp xác định lại mỗi mẫu nên làm 2 giếng);

- Phủ kín đĩa và ủ ở t ấm 37 °C (4.4.1) trong vòng 30 min;

- Rửa đĩa 4 lần bằng dung dịch đệm (6.3.4.1);

- Nhỏ 100 ml dung dịch kháng kháng thể bò đã pha loãng (6.3.4.1) vào từng giếng;

- Ph kín đĩa ủ ở tủ ấm 37 °C (4.4.1) trong 30 min;

- Rửa đĩa 4 lần bằng dung dịch đệm;

- Nh 100 ml dung dịch cơ cht vào mỗi giếng;

- Phủ kín đĩa và ủ ở nhiệt độ phòng từ 18 °C đến 25 °C trong 30 min;

- Nhỏ 100 ml dung dịch dừng phản ứng vào mỗi giếng;

- Phủ kín đĩa và ủ ở nhiệt độ phòng từ 18 °C đến 25 °C trong 30 min;

- Đọc đĩa ở bước sóng 405 nm bằng máy đọc ELISA (4.4.2) trong vòng 15 min.

6.3.5. Đọc kết quả

- Tính giá tr mật độ quang học (OD) của mẫu kiểm chứng âm, mẫu kiểm chứng dương và mẫu bệnh phẩm.

- Tính tỷ lệ giá trị OD giữa mẫu bệnh phẩm hoặc mẫu kiểm chứng âm với mẫu kiểm chứng dương (PP) theo công thức sau:

PP =

OD mẫu bệnh phẩm hoặc mẫu kiểm chng âm

x 100

OD mẫu kiểm chứng dương

- Giá trị mẫu kiểm chứng nằm trong khoảng giới hạn sau:

1) OD của mẫu kiểm chứng dương: ln hơn khoảng giá trị từ 0,9 đến 2,3;

2) PP của mẫu kiểm chứng âm: nhỏ hơn 20.

- Đánh giá kết quả đối với mẫu bệnh phẩm:

1) PP nhỏ hơn 25: mẫu âm tính;

2) PP lớn hơn hoặc bằng 25: mẫu dương tính.

CHÚ THÍCH: Kít phát hiện kháng thể biên trùng không thể phân biệt được kháng thể do nhiễm tự nhiên hay kháng thể do tiêm vắc xin.

6.4. Phương pháp CAT phát hiện kháng thể biên trùng

6.4.1. Lấy mẫu

Xem 6.3.1.

6.4.2. Bảo quản mu

Xem 6.3.2.

6.4.3. Chun bị mẫu

Xem 6.3.3.

6.4.4. Cách tiến hành

6.4.4.1. Chun bị kháng nguyên

Gây nhiễm qua đường tĩnh mạch bằng máu có chứa Anaplasma spp. vào con bê cắt lách. Ly máu của con vật kiểm tra, nếu 50% máu con vật nhiễm Anaplasma spp. thì đem rửa, ly giải và ly tâm (4.3.1) để thu hồi Anaplasma spp. ở dạng viên. Phần kháng nguyên dạng viên sau khi đánh tan, rửa và cho vào dung dịch thuốc nhuộm để tạo huyễn dịch kháng nguyên cuối cùng.

6.4.4.2. Tiến hành phản ứng

- Các thuốc thử để ở nhiệt độ từ 25 °C đến 26 °C trước khi sử dụng;

- Trên mỗi vòng tròn của bản nhựa: nh 10 ml huyết thanh bò không bị nhiễm Anaplsama (nồng độ conglutinin cao), 10 ml mẫu bệnh phẩm (6.4.3) và 5 ml kháng nguyên (6.4.4.1). Mu kiểm chứng âm và dương cũng được thực hiện trên mỗi bản nhựa.

- Trộn các thành phần đã cho vào vòng tròn bản nhựa bằng đũa thủy tinh. Sau khi trộn mỗi phản ứng, ra sạch đũa thủy tinh để tránh tạp sang mẫu khác;

- Đặt bản nhựa kiểm tra trên máy lắc (4.5) với tốc độ từ 100 r/min đến 110 r/min trong 7 min.

6.4.5. Đọc kết quả

- Nếu phát hiện đám kết tủa: mẫu dương tính;

- Nếu không có đám kết tủa: mẫu âm tính.

CHÚ THÍCH: Phản ứng CAT có ưu điểm nhạy, có thể thực hiện trong phòng thí nghiệm hoặc ngoài thực địa và cho kết quả trong vài phút. Tuy nhiên phương pháp này không đặc hiệu do kháng nguyên thay đổi theo quy trình sản xuất của từng phòng thí nghiệm.

7. Kết luận

Trâu bò được kết luận là mắc bệnh biên trùng khi có các đặc điểm dịch tễ, triệu chứng lâm sàng, bệnh tích đại thể của bệnh và có kết quả xét nghiệm kháng nguyên hoặc kháng thể dương tính bằng một trong những phương pháp quy định trong tiêu chuẩn này.

 

Phụ lục A

(Quy định)

Thành phần và chuẩn bị thuốc thử cho phương pháp nhuộm Giemsa

A.1. Dung dịch muối đệm phosphat (PBS), 0,01 M, pH 7,0

A.1.1. Thành phần

Natri hydrophosphat (Na2HPO4)                                                  9,47 g

Kali dihydrophosphat (KH2PO4)                                                  9,08 g

Nước cất                                                                                  900 ml

A.1.2. Chuẩn bị

Hòa tan natri hydrophosphat và kali dihydrophosphat trong 900 ml nước cất. Chỉnh pH đến 7,0 bằng axit clohydric.

CHÚ THÍCH: Có thể sử dụng PBS thương mại và chun bị theo hướng dẫn của nhà sản xut.

A.2. Dung dịch Giemsa, 10 %

Dung dịch Giemsa (azur-eosin-methylen blue)                             1 phần

Dung dịch PBS 0,01 M, pH 7,0 (A.1)                                          9 phần

CHÚ THÍCH: Nồng độ dung dịch Giemsa có thể thay đi theo các phòng thí nghiệm.

 

Phụ lục B

(Tham khảo)

Quy trình tách chiết ADN

CẢNH BÁO: Việc tách chiết ADN có sử dụng hóa chất nguy hiểm và có khả năng gây hại nếu thao tác không cẩn thận. Do vậy, nên tránh tiếp xúc trực tiếp với da và hít phải hơi của các hóa chất này. Luôn luôn đeo găng tay, khẩu trang, mặc quần áo bảo hộ khi thực hiện các thao tác này.

Quy trình tách chiết ADN sử dụng kít DNeasy® Blood & Tissue Kit (250) (Cat No. 69506) như sau:

B.1. Pha dung dịch

- Dung dịch AW 1 (Wash buffer 1): thêm 125 ml etanol từ 96 % đến 100 % (thể tích) (3.2.5) vào 95 ml dung dịch AW1 đậm đặc;

- Dung dịch AW 2 (Wash buffer 2): thêm 160 ml etanol từ 96 % đến 100 % (thể tích) (3.2.5) vào 66 ml dung dịch AW2 đậm đặc.

B.2. Cách tiến hành

- Bước 1: nhỏ 20 ml proteinase K vào ống 1,5 ml; nhỏ thêm 100 ml mẫu máu (6.2,3); và thêm dung dịch PBS để được thể tích 220 ml. Tiến hành tiếp bước 2;

- Bước 2: nh 200 ml dung dịch AL (Lysis buffer) vào ống; trộn đều bằng máy lắc trộn vortex (4.1.3) trong 15 s. mẫu ở 56 °C trong 15 min;

- Bước 3: nhỏ 200 ml etanol từ 96 % đến 100 % (th tích) (3.2.5) vào ng, trộn đều bằng máy lắc trộn vortex (4.1.3).

- Bước 4: chuyển toàn bộ dung dịch trong ống vào cột lọc có ống thu; ly tâm cột lọc và ống thu ở gia tốc 6 000 g bằng máy ly tâm (4.3.1) trong 1 min, loại bỏ ống thu;

- Bước 5: chuyển cột lọc sang ống thu mới; nhỏ 500 ml dung dịch AW 1, ly tâm ở gia tốc 6 000 g bng máy ly tâm (4.3.1) trong 1 min, loại bỏ ống thu;

- Bước 6: chuyển cột lọc sang ống thu mới; nhỏ 500 ml dung dịch AW 2, ly tâm ở gia tốc 20 000 g bằng máy ly tâm (4.3.1) trong 3 min, loại b ống thu;

- Bước 7: chuyển cột lọc sang ống 1,5 ml hoặc 2 ml sạch;

- Bước 8: nhỏ 50 ml dung dịch AE (Elution buffer) vào giữa màng cột lọc, ủ 1 min ở nhiệt độ phòng (từ 15 °C đến 25 °C); ly tâm cột lọc và ống 1,5 ml hoặc 2 ml ở gia tốc 6 000 g bằng máy ly tâm (4.3.1) trong 1 min

- Bước 9: bỏ cột lọc, giữ lại ống 1,5 ml hoặc 2 ml có chứa ADN;

Bảo quản ADN ở t lạnh (4.1.2) nếu thực hiện phản ứng realtime PCR ngay hoặc ở tủ lạnh âm sâu (4.1.1) nếu thực hiện phản ứng realtime PCR sau 24 h.

 

THƯ MỤC TÀI LIỆU THAM KHẢO

[1] Carelli G., Decaro N., Lorusso A., Elia G., Lorusso E., Mari V., Ceci L and Buonavoglia C. (2007). Detection and quantification of Anaplasma marginale DNA in blood samples of cattle by real-time PCR. Vet. Microbiol., 124, 107-114.

[2] A. marginale Antibody Test. Available at: http://www.svanova.com/content/dam/internet/ah/svanova/dk_EN/documents/Kit%20inserts/lnsert%20A%20marginale%2019-2960-00_04.pdf.

[3] Phạm Văn Khuê và Phan Lục, 1996, Giáo trình ký sinh trùng thú y. NXB Đại học Nông nghiệp I, 243-244.

[4] Reinbold J.B., Coetzee J.F., Sirigireddy K.R & Ganta R.R (2010). Detection of Anaplasma marginale and A. phagocytophilumin bovine peripheral blood samples by duplex real-time reverse transcriptase PCR assay. J.CIin. Microbiol., 48, 2424-2432.

 

1) Thông tin này đưa ra tạo điều kiện thuận tiện cho người sử dụng tiêu chuẩn và không n định sử dụng sản phm của nhà cung cp này. Có thể sử dụng các sản phẩm tương tự nếu cho các kết quả tương đương.

2) Thông tin này đưa ra tạo điều kiện thuận tiện cho người s dụng tiêu chun và không n định sử dụng sản phm của nhà cung cp này. Có thể sử dụng các sản phẩm tương tự nếu cho các kết qu tương đương. Tuy nhiên, thành phần và thể tích của phn ứng realtime PCR có thể thay đi phù hợp với từng phòng thí nghiệm

3) Thông tin này đưa ra tạo điều kiện thuận tin cho người sử dụng tiêu chun và không ấn định sử dụng sản phẩm của nhà cung cấp này. Có thể sử dụng các sản phm tương tự nếu cho các kết quả tương đương.

Tải App LuatVietnam miễn phí trên Android tại đây trên IOS tại đây. Xem thêm

Tiêu chuẩn Việt Nam
Tiêu chuẩn Quốc gia TCVN 8400-34:2015 Bệnh động vật-Quy trình chẩn đoán-Phần 34: Bệnh biên trùng ở trâu bò
Số hiệu: TCVN 8400-34:2015 Loại Văn bản: Tiêu chuẩn Việt Nam
Cơ quan ban hành: Bộ Khoa học và Công nghệ Lĩnh vực: Nông nghiệp-Lâm nghiệp
Năm ban hành 2015 Hiệu lực:
Người ký: Tình trạng hiệu lực: Đã biết

Tải App LuatVietnam miễn phí trên Android tại đây trên IOS tại đây. Xem thêm

Văn bản cùng lĩnh vực
Văn bản cùng lĩnh vực