Tiêu chuẩn TCVN 8400-4:2010 Quy trình chẩn đoán bệnh Niu cát xơn ở gà

Thuộc tính Nội dung Tiêu chuẩn liên quan Lược đồ Tải về
LuatVietnam.vn độc quyền cung cấp bản dịch chính thống Công báo tiếng Anh của Thông Tấn Xã Việt Nam

TIÊU CHUẨN QUỐC GIA

TCVN 8400-4:2010

BỆNH ĐỘNG VẬT - QUY TRÌNH CHẨN ĐOÁN - PHẦN 4: BỆNH NIU CÁT XƠN

Animal disease - Diagnostic procedure - Part 4: Newcastle disease

Lời nói đầu

TCVN 8400-4:2010 do Cục Thú y biên soạn, Bộ Nông nghiệp và Phát triển nông thôn đề nghị, Tổng cục Tiêu chuẩn Đo lường Chất lượng thm định, Bộ Khoa học và Công nghệ công bố.

TCVN 8400 Bệnh động vật - Quy trình chẩn đoán gồm có các phần sau:

- TCVN 8400-1:2010 Bệnh động vật - Quy trình chn đoán - Phần 1: Bệnh l mồm long móng;

- TCVN 8400-2:2010 Bệnh động vật - Quy trình chẩn đoán - Phần 2: Bệnh do vi khuẩn Streptococcus suis gây ra trên lợn;

- TCVN 8400-3:2010 Bệnh động vật - Quy trình chẩn đoán - Phần 3: Bệnh giun xoắn;

- TCVN 8400-4:2010 Bệnh động vật - Quy trình chẩn đoán - Phần 4: Bệnh Niu cát xơn.

 

BỆNH ĐỘNG VẬT - QUY TRÌNH CHẨN ĐOÁN - PHẦN 4: BỆNH NIU CÁT XƠN

Animal disease - Diagnostic procedure - Part 4: Newcastle disease

CNH BÁO - Việc áp dụng tiêu chuẩn này có thể liên quan đến các vật liệu, thiết bị và các thao tác gây nguy hiểm. Tiêu chuẩn này không thể đưa ra được hết tất cả các vấn đề an toàn liên quan đến việc sử dụng chúng. Người sử dụng tiêu chuẩn này phải tự thiết lập các thao tác an toàn sức khỏe thích hợp và xác định khả năng áp dụng các giới hạn quy định trước khi sử dụng tiêu chuẩn.

1. Phạm vi áp dụng

Tiêu chuẩn này quy định quy trình chẩn đoán bệnh Niu cát xơn đối với gà.

2. Thuật ngữ và định nghĩa

Trong tiêu chuẩn này sử dụng thuật ngữ và định nghĩa sau:

Bệnh Niu cát xơn (Newcastle disease)

Bệnh truyền nhiễm cấp tính, lây lan cho gà mọi lứa tuổi, bệnh gây ra bởi virus thuộc họ Paramyxoviridae phân nhóm PMV-1. Virus Niu cát xơn có nhiều chủng:

- Chủng có độc lực cao gây xuất huyết đường tiêu hóa;

- Chủng có độc lực cao gây tỷ lệ chết cao, có triệu chứng hô hấp và thần kinh;

- Chủng có độc lực vừa phải gây triệu chứng hô hấp, đôi khi có triệu chứng thần kinh, tỷ lệ chết thấp;

- Chủng có độc lực yếu gây nhiễm đường hô hấp ở thể nhẹ hoặc cận lâm sàng;

- Chng có độc lực yếu gây thể đường ruột nhẹ (Asymtomatic enteric).

3. Thuốc thử và vật liệu thử

Ch sử dụng thuốc thử loại tinh khiết phân tích và sử dụng nước cất hai lần hoặc nước đã khử khoáng hoặc nước có độ tinh khiết tương đương, tr khi có quy định khác.

- Natri clorua (NaCI).

- Kali clorua (KCI).

- Natri phosphat dibasic ngậm hai phân tử nước (Na2HPO4.2H2O).

- Kali dihydro phosphat (KH2PO4).

- Chất chống đông trinatri xitrat (C6H5Na3O7.2H2O).

- Cồn 96 %.

- Hồng cầu gà

- Kháng sinh: Penicyline, Streptomycine, Kanamycine.

- Kháng nguyên chuẩn Niu cát xơn.

- Kháng huyết thanh chuẩn Niu cát xơn.

- Mồi và probe đặc hiệu.

- Kit chiết tách RNA.

- Kit nhân gen.

4. Thiết bị, dụng cụ

Sử dụng các thiết bị, dụng cụ của phòng thử nghiệm thông thường và cụ thể như sau:

- Tủ lạnh.

- Tủ ấm 37 °C.

- Tủ sấy từ 100 °C đến 200 °C.

- Tủ ấp trứng.

- Ni hấp ướt.

- Máy li tâm Hematocrit.

- Máy ly tâm tốc độ đến 2000 xg.

- Máy ly tâm tốc độ trên 20000 xg.

- Máy realtime PCR.

- Máy lắc đĩa 96 giếng làm phản ứng ngưng kết.

- Micropipet đơn kênh cỡ từ 0,5 ml đến 10 ml; 1 ml đến 20 ml; 20 ml đến 200 ml; 100 ml đến 1000 ml.

- Micropipet đa kênh cỡ từ 5 ml đến 50 ml.

- Đầu tip phù hợp với các loại micropipet (có lọc và không lọc).

- Ống nghiệm, dung tích 10 ml.

- Ống Eppendorf, dung tích từ 1,5 ml đến 2 ml.

- Bơm tiêm, dung tích 1 ml, 2 ml, 5 ml.

- Bộ cối chày sứ.

- Dụng cụ dao, kéo, panh, kẹp.

- Đĩa phản ứng 96 giếng, đáy chữ U hoặc V.

5. Lấy mẫu

Lấy mẫu vào thời kỳ đầu của ổ dịch. Lấy ngay sau khi con vật ốm, chết hoặc mổ khám.

Mu bệnh phẩm là não (đầu gà), phủ tạng (gan, lách, thận, phổi). Nếu là gà bệnh hoặc xác gà mới chết phải lấy tối thiểu 3 con để mổ khám. Nếu đàn gà chưa tiêm phòng Niu cát xơn, cần lấy thêm ít nhất 10 mẫu huyết thanh để kiểm tra kháng thể kháng Niu cát xơn trong đàn.

Mẫu được bảo quản và vận chuyển trong điều kiện lạnh từ 2 °C đến 8 °C.

Mẫu bệnh phẩm gửi đến phòng xét nghiệm càng sớm càng tốt, kèm theo phiếu gửi bệnh phẩm.

6. Cách tiến hành

6.1. Chẩn đoán lâm sàng

6.1.1. Dịch tễ học

Nghiên cứu về diễn biến dịch tễ học như đường lây truyền bệnh, lứa tuổi mắc bệnh, tỷ lệ ốm, chết, nguồn bệnh, nguyên nhân gây bệnh... Bệnh Niu cát xơn lây lan chủ yếu qua tiếp xúc trực tiếp giữa các gà khỏe mạnh và gà bị nhiễm bệnh. Bệnh được truyền qua phân gia cầm mắc bệnh và các dịch tiết từ mũi, miệng và mắt. Bệnh lây lan nhanh và có thể lây lan dễ dàng bằng phương tiện cơ học mang virus như giày dép và quần áo mang từ một đàn bị nhiễm đến. Virus Niu cát xơn có thể sống sót trong vài tuần trong môi trường ẩm ướt trên lông chim, phân bón. Bệnh Niu cát xơn có tỷ lệ ốm và chết cao.

6.1.2. Triệu chứng lâm sàng

- Ủ rũ, ít vận động, nhắm mắt, uống nhiều nước, mào tím tái.

- Khó th, ho, ngáp, lắc đầu, dịch nhớt chảy ra từ mũi, miệng, diều căng đầy hơi.

- Giảm đ, trứng biến dạng, vỏ xù xì hoặc thiếu canxi.

- Phân lỏng, màu trắng xanh, dính bết vào lông quanh lỗ huyệt.

- Gà bị bệnh sau từ 5 ngày đến 6 ngày xuất hiện triệu chứng thần kinh: Vẹo c, bước vòng tròn, liệt chân cánh.

6.1.3. Giải phẫu bệnh học

Tùy theo thể bệnh có thể thấy nhiều hoặc một trong những bệnh tích đặc trưng sau:

- Thanh, khí quản đọng dịch nhầy, xuất huyết.

- Phổi xut huyết lấm tấm.

- Niêm mạc miệng, thực quản có điểm xuất huyết.

- Diều chứa đầy thức ăn và dịch. Niêm mạc giữa dạ dày tuyến và dạ dày cơ (cuống mề) có điểm xuất huyết.

- Niêm mạc ruột viêm, xuất huyết, có nốt loét hình cúc áo. Manh tràng xut huyết. Trực tràng, hậu môn viêm loét, xuất huyết.

- Buồng trứng xuất huyết, trứng non vỡ trong xoang bụng gây viêm phúc mạc.

6.2. Chẩn đoán phòng thí nghiệm

6.2.1. Phát hiện kháng nguyên

6.2.1.1. Xử lý bệnh phẩm

Bệnh phẩm là phủ tạng, não lấy từ gia cầm chết, bị bệnh nghi nhiễm Niu cát xơn được nghiền thành huyễn dịch 10 % với dung dịch nước sinh lý hoặc PBS. Sau đó ly tâm với tốc độ 1000 xg trong 10 min.

Thu lấy dịch nổi, xử lý vô trùng bằng dung dịch kháng khuẩn (0,1 ml/ 10 ml huyễn dịch) hoặc lọc qua bộ lọc màng 0,45 mm. Huyễn dịch bệnh phẩm đã xử lý có th dùng để chẩn đoán phát hiện virus Niu cát xơn bằng phản ứng Realtime RT-PCR hoặc phân lập virus trên trứng gà có phôi.

6.2.1.2. Phương pháp Realtime RT- PCR (rRT-PCR)

- Chiết tách ARN của virus Niu cát xơn: theo hướng dẫn của nhà sản xuất kít;

- Tiến hành phản ứng realtime RT-PCR (Phụ lục A).

6.2.1.3. Phân lập virus trên trứng gà có phôi

6.2.1.3.1. Cách tiến hành

- Tiêm truyền huyễn dịch bệnh phẩm vào trứng gà có phôi từ 9 ngày đến 11 ngày tuổi, tiếp tục ấp ở nhiệt độ 37 °C trong 3 đến 5 ngày (Phụ lục C);

- Theo dõi trứng sau khi tiêm, thu hoạch nước trứng (Phụ lục C);

- Làm phản ứng ngưng kết hồng cầu (HA) (Phụ lục D);

- Giám định các mẫu nước trứng dương tính HA bằng phản ứng ngăn tr ngưng kết hồng cầu (HI) với kháng thể kháng Niu cát xơn chuẩn (Phụ lục E).

- Ngoài ra có thể giám định virus Niu cát xơn bằng phản ứng rRT-PCR.

6.2.1.3.2. Đánh giá kết qu

- Nếu kết quả HA dương tính và HI dương tính, xác định có virus Niu cát xơn trong mẫu.

- Nếu kết quả HA dương tính và HI âm tính, xác định không có virus Niu cát xơn.

- Nếu kết quả HA âm tính, phôi chết, có xuất huyết cần tiêm truyền lần 2. Nếu sau lần 2 vẫn âm tính thì kết luận mẫu âm tính với virus Niu cát xơn.

6.2.2. Phát hiện kháng thể

Phát hiện kháng thể kháng Niu cát xơn bằng phải ứng HI với kháng nguyên chuẩn (Phụ lục E). Đàn gà chưa tiêm phòng Niu cát xơn mà dương tính kháng thể thì kết luận đàn đó nhiễm virus Niu cát xơn.

6.2.3. Xác định độc lực của virus Niu cát xơn (tùy theo yêu cầu chẩn đoán)

Virus Niu cát xơn có 3 nhóm độc lực chính:

- Nhóm độc lực cao (Velogenic): Gây xuất huyết đường tiêu hóa, có t lệ chết cao.

- Nhóm độc lực vừa (Mesogenic): Triệu chứng hô hấp, đôi khi có triệu chứng thần kinh, tỷ lệ chết thấp.

- Nhóm độc lực yếu (Lentogenic): Gây nhiễm đường hô hấp ở thể nhẹ.

Theo OIE, chỉ số độc lực khi tiêm truyền vào não gà con (ICPI) được dùng để đánh giá độc lực của virus Niu cát xơn. Đối với nhóm Lentogenic, ch số ICPI xấp xỉ 0. Nếu ICPI ³ 0,7 thì được coi là virus có độc lực gây nên ổ dịch Niu cát xơn (Phụ lục F).

7. Kết luận

Gà được xác định mắc bệnh Niu cát xơn khi có các đặc điểm dịch tễ học, triệu chứng lâm sàng, giải phẫu bệnh tích của bệnh Niu cát xơn và kết quả dương tính với một trong những phương pháp xét nghiệm sau:

- Phản ứng rRT-PCR phát hiện virus dương tính.

- Phân lập được virus trên trứng gà có phôi, và giám định virus Niu cát xơn dương tính.

 

Phụ lục A

(Quy định)

Kỹ thuật Realtime RT-PCR

A.1. Chiết tách RNA

Chiết tách RNA theo hướng dẫn của nhà sản xuất kit.

A.2. Tiến hành phản ứng rRT-PCR

A.2.1. Chuẩn bị master mix (hỗn hợp phản ứng)

Công thức này có thể thay đổi cho phù hợp với từng loại mồi và từng loại kit RT-PCR khác nhau. Dưới đây quy trình giới thiệu 2 bộ kit.

- Công thức áp dụng cho kit RT-PCR 1 bước của hãng Qiagen:

Thành phần

Lượng (ml)

H2O

10,5

5X hỗn hợp phản ứng

5,0

MgCl2

1,2

dNTP

0,8

Hỗn hợp enzym

1

Mồi xuôi

0,5

Mồi ngược

0,5

Probe

0,5

Mẫu RNA

5

Tng cộng

25

- Công thức áp dụng cho kit RT-PCR của hãng Invitrogen:

Thành phần

Lượng (ml)

H2O

5,5

2X hỗn hợp phản ứng

12,5

Hỗn hợp enzym

0,5

Mồi xuôi

0,5

Mồi ngược

0,5

Probe

0,5

Mu RNA

5

Tổng cộng

25

A.2.2. Tiến hành phản ứng

Đặt ống phản ứng vào máy chu kỳ nhiệt và chọn chương trình chạy PCR bng phần mềm trên máy vi tính.

Qiagen one-step RT-PCR Kit

Invitrogen superscript 3 qRT-PCR Kit

RT

PCR

RT

PCR

50 °C-30 min

95 °C-15 min

40 x (95 °C-10 s + 58 °C-50 s)

50 °C-15 min

95 °C-2 min

40 x (95 °C-10 s + 58 °C-50 s)

Trình tự chuỗi mồi và probe dùng trong phản ứng rRT-PCR

Gen mục tiêu

Tên PPP

Mồi/ Probe

Trình tự (5 - 3’)

Điều chnh

5’

3’

Avian paramyxovirus type 1 (Matrix)

APMV

Probe

TTCTCTAGCAGTGGGACAGCCTGC

FAM

BHQ1

Xuôi

AGTGTAGTGCTCGGACCTTC

None

None

Ngược

CCTGAGGAGAGGCATTTGCTA

None

None

Newcastle disease virus (vero+meso) (Fusion)

NDV-1

Probe

AAGCGTTTCTGTCTCCTCCTCCA

TET

BHQ1

Xuôi

GGTGAGTCTATCCGGARGATACAAG

None

None

Ngược

AGCTGTTGCAACCCCAAG

None

None

Newcastle disease virus (vero+meso) (Fusion)

NDV-2

Probe

CCGGCATTCTGGTTTCACTCAA

FAM

BHQ1

Xuôi

CGTTCTGAGGAATTTGACAGYMT

None

None

Ngược

GRAGCCATGCGAAYTTGG

None

None

A.3. Đánh giá kết quả xét nghiệm

- Mu đối chứng dương tính (được chuẩn độ trước) phải giá trị Ct (ngưỡng vòng) như đã biết (± 2 Ct) và mẫu đối chứng âm tính phải có Ct = 0 thì kết qurRT-PCR mới được công nhận.

- Mu có giá trị Ct £ 35 được coi là dương tính.

- Mẫu không có Ct được coi là âm tính.

- Mẫu có giá trị Ct trong khoảng từ 35 đến 40 được coi là nghi ngờ. Những mẫu nghi ngờ này cần được xác chn bằng phương pháp phân lập virus trước khi có kết luận chẩn đoán cuối cùng.

 

Phụ lục B

(Quy định)

Chuẩn bị huyễn dịch hồng cầu gà 1 %

Gà lấy máu là gà trống đã trưng thành, khỏe mạnh, âm tính kháng thể Niu cát xơn. Nuôi gà ở chuồng an toàn dịch bệnh, dùng để lấy máu thường xuyên.

Sát trùng vị trí lấy máu (tĩnh mạch cánh hoặc tim) bằng bông cồn 70 %.

Dùng bơm tiêm từ 5 ml đến 10 ml hút khoảng 1ml dung dịch chống đông (Natri xitrat 4 %            hoặc Alserver...) hút lấy máu gà. Cho máu vào ống nghiệm.

Rửa hồng cầu: Cho nước sinh lý (hoặc PBS) vào ống lấy máu, một lượng gấp đôi lượng máu trong ống, lắc đều. Ly tâm ở 1000 xg trong 10 min, bỏ huyết tương ở trên. Rửa như trên từ 2 lần đến 3 lần. Sau lần ly tâm cuối, bỏ nước ở trên, lấy hồng cầu để pha. Hoặc có thể sử dụng máy ly tâm Hematocrit để ly tâm sẽ được hồng cầu đặc có lượng chính xác khi pha.

Pha hồng cầu thành huyễn dịch 1 %. Ví dụ: 1ml hồng cầu đặc và 99 ml nước sinh lý.

Bảo quản huyễn dịch hồng cầu ở nhiệt độ từ 4 °C đến 8 °C. Hồng cầu sau khi pha có thể dùng trong một tuần (nếu huyễn dịch hồng cầu bị dung huyết phải loại b). Hồng cầu không dùng hết, cần cho nước sinh lý (hoặc PBS, Alserver) vào bảo quản. Khi cần, ly tâm lại để dùng.

 

Phụ lục C

(Quy định)

Phương pháp tiêm truyền bệnh phẩm vào trứng gà có phôi

C.1. Xử lý bệnh phẩm

Não hoặc các phủ tạng được nghiền trong cối chày sứ vô trùng, pha thành huyễn dịch 1 : 10 vi nước sinh lý (hoặc PBS pH từ 7,0 đến 7,4) có kháng sinh (Penicillin 200 Ul/ml, Streptomycin 2 mg/ml). Để ở tủ lạnh 4 °C trong 2 h. Ly tâm ở 1000 xg trong 15 min, lấy nước trong ở trên để tiêm phôi trứng.

C.2. Tiêm trứng gà có phôi

- Dùng trứng gà có phôi từ 9 ngày tuổi đến 11 ngày tuổi, lấy từ trại gà sạch bệnh;

- Soi trứng, chọn phôi khỏe. Mỗi mẫu bệnh phm tiêm từ 3 phôi đến 5 phôi;

- Sát trùng vỏ trứng bằng cồn 70 %. Dùi vị trí tiêm ở phía trên buồng hơi;

- Dùng bơm tiêm hút dịch bệnh phẩm rồi tiêm 0,2 ml vào xoang niệu mô;

- Gắn kín lỗ tiêm bằng keo;

- Ủ ấm trong tủ m từ 37 °C đến 38 °C. Ngày soi trứng 2 lần, loại bỏ phôi chết trước 24 h. Theo dõi từ 5 ngày đến 7 ngày;

- Các trứng có phôi chết hoặc gần chết để vào tủ lạnh 4 °C. Phôi nhiễm virus Niu cát xơn cường độc thường chết từ 24 h đến 60 h;

- Sau 5 ngày đến 7 ngày các trứng không chết được để tủ lạnh 4 °C giết phôi.

C.3. Thu hoạch nước trứng

- Mổ trứng trong điều kiện vô trùng. Sát trùng vỏ trứng bằng cồn 70 %;

- Dùng kéo cắt quanh buồng hơi, bộc lộ xoang niệu mô;

- Hút nước trứng vào ống Eppendorf vô trùng, bảo quản ở nhiệt độ 4 °C để kiểm tra;

- Kiểm tra bệnh tích: phôi có xuất huyết lấm tm ở da đầu, thân, chân, cánh;

Nước trứng sau khi thu hoạch được làm phản ứng ngưng kết hồng cầu-HA nhm xác định sự nhân lên của virus trong phôi.

 

Phụ lục D

(Quy định)

Kỹ thuật làm phản ứng ngưng kết hồng cầu gà

D.1. Nguyên liệu

- Hồng cầu gà 1 % (Phụ lục B).

- Nước trứng thu hoạch (hoặc kháng nguyên chuẩn Niu cát xơn).

- Dung dịch PBS pH từ 7,0 đến 7,4.

D.2. Tiến hành phản ứng

Dùng đĩa ngưng kết 96 giếng, đáy chữ V hoặc chữ U. Bổ sung 25 ml PBS từ giếng 1 đến giếng 12. Thêm 25 ml kháng nguyên (nước trứng thu hoạch hoặc kháng nguyên chuẩn) vào giếng 1;

Pha loãng kháng nguyên: trộn đều kháng nguyên với PBS ở giếng 1, hút 25 ml chuyển sang giếng 2 trộn đều, hút 25 ml chuyển sang giếng 3 trộn đều, tiếp tục làm như vậy đến giếng 11, hút bỏ 25 ml ở giếng 11. Giếng 12 chỉ có PBS để làm đối chứng hồng cầu.

Nh thêm 25 ml PBS vào tất cả các giếng.

Thêm hồng cầu: Mỗi giếng 25 ml, lắc nhẹ 1 min. Để đĩa phản ứng ở nhiệt độ phòng. Sau 15 min đến 25 min đọc kết quả (không đọc muộn hơn 25 min).

D.3. Đọc kết quả

- Phản ứng dương tính: Có hạt ngưng kết lấm chấm.

- Phản ứng âm tính: Hồng cầu lắng xuống đáy tạo thành chm tròn.

Hiệu giá ngưng kết HA đưc tính ở độ pha loãng kháng nguyên cao nhất còn xuất hiện ngưng kết hoàn toàn. Ví dụ: giếng cuối cùng còn có ngưng kết hoàn toàn, hiệu giá HA = 1/256 (hay 8 log2).

Nguyên liệu

Giếng

1

2

3

4

5

6

7

8

9

10

11

12

đối chứng

PBS (ml)

25

25

25

25

25

25

25

25

25

25

25

25

Kháng nguyên (ml)

25

Trộn đều, chuyển 25 từ giếng 1 đến 11 rồi hút bỏ 25 ml

0

PBS

(ml)

25

25

25

25

25

25

25

25

25

25

25

25

Hồng cầu (ml)

25

25

25

25

25

25

25

25

25

25

25

25

Độ pha loãng KN

 

D.4. Nhận định kết quả

- Nếu HA dương tính: Kết luận có virus gây bệnh. Để xác định là virus Niu cát xơn cần phải làm phản ứng HI với kháng huyết thanh dương tính chuẩn Niu cát xơn.

- Nếu phản ứng HA âm tính: Có thể trong bệnh phẩm không có mặt virus Niu cát xơn hoặc lượng virus quá ít. Vì vậy, cần tiêm phôi trứng 1 lần nữa (dùng nước trứng thu hoạch lần 1 để tiêm truyền)

 

Phụ lục E

(Quy định)

Kỹ thuật làm phản ứng ngăn trở ngưng kết hồng cầu gà

E.1. Nguyên liệu

- Dung dịch PBS pH từ 7,0 đến 7,4.

- Hồng cầu gà 1 %.

- Huyết thanh kiểm tra (hoặc kháng huyết thanh chuẩn Niu cát xơn).

- Kháng nguyên chuẩn Niu cát xơn (hoặc nước trứng thu hoạch).

- Kháng nguyên dùng cho phản ứng HI được pha 4 HAU.

E.2. Cách pha và chuẩn độ kháng nguyên 4 HAU

Ví dụ: Hiệu giá kháng nguyên trong phản ứng HA là 1/256 thì 4 HAU bằng 1/256 x 4 = 1/64.

Pha 4 HAU gồm 1 phần kháng nguyên và 63 phần PBS.

Chuẩn độ kháng nguyên 4 HAU đã pha bằng phản ứng HA. Nếu kết quả ngưng kết đến giếng thứ 2, như vậy kháng nguyên pha đạt. Nếu ngưng kết đến giếng thứ 3 (hoặc hơn) là kháng nguyên pha đặc. Nếu ngưng kết ch ở giếng đầu tiên là kháng nguyên pha loãng. Dựa vào kết quả đó để bổ sung thêm kháng nguyên hoặc PBS để có kháng nguyên 4 HAU chuẩn.

E.3. Trình tự tiến hành phản ứng

Nguyên liệu

Giếng

1

2

3

4

5

6

7

8

9

10

11

12

đối chứng

PBS (ml)

25

25

25

25

25

25

25

25

25

25

25

50

Huyết thanh

25

Trộn đều, chuyển 25 từ giếng 1 đến 11 rồi hút bỏ 25 ml

0

KN 4 HA (ml)

25

25

25

25

25

25

25

25

25

25

25

0

Lắc đều, để 30 min ở nhiệt độ phòng

Hồng cầu (ml)

25

25

25

25

25

25

25

25

25

25

25

25

Độ pha loãng HT

 

E.3.1. Cách tiến hành

Dùng đĩa ngưng kết 96 giếng, đáy chữ V hoặc chữ U;

Cho PBS vào mỗi giếng 25 ml từ giếng 1 đến giếng 12;

Cho 25 ml huyết thanh cần kiểm tra vào giếng 1;

Pha loãng huyết thanh: Trộn đều huyết thanh với PBS ở giếng 1, rồi hút 25 ml chuyển sang giếng 2 trộn đều, hút 25 ml chuyển sang giếng 3 tiếp tục làm như vậy đến giếng 11, hút bỏ 25 ml đi ở giếng 11;

Cho kháng nguyên 4 đơn vị HA vào các giếng từ số 1 đến số 11, mỗi giếng 25 ml. Giếng 12 cho thêm 25 ml PBS;

Lắc nhẹ, để 30 min ở nhiệt độ phòng;

Cho hồng cầu: Mỗi giếng 25 ml, lắc nhẹ 1 min. Để đĩa phản ứng nhiệt độ phòng. Sau 15 min đến 25 min đọc kết quả (không đọc muộn hơn 25 min).

E.3.2. Đọc kết quả

Phản ứng dương tính: Hồng cầu lắng xuống đáy, chứng tỏ kháng nguyên và kháng thể tương ứng.

Hiệu giá kháng thể được tính ở độ pha loãng cao nhất còn có hiện tượng ức chế ngưng kết hoàn toàn.

Phản ứng âm tính: Có hạt ngưng kết lấm tấm. Chứng tỏ không có sự kết hợp giữa kháng nguyên và kháng thể trong phản ứng.

E.4. Đánh giá kết quả

Mẫu là huyết thanh kiểm tra kháng thể: Các con gà chưa được chủng vắc xin có kháng thể lớn hơn hoặc bằng 1/16 (4 log2) thì mẫu đó được coi là nhiễm virus Niu cát xơn.

Mu là kháng nguyên (nước trứng giám định virus phân lập):

- Nếu có hiện tượng ức chế ngưng kết với kháng huyết thanh chuẩn Niu cát xơn chứng tỏ virus phân lập là virus Niu cát xơn.

- Nếu không có hiện tượng ức chế ngưng kết, mà phôi chết, có bệnh tích xuất huyết đồng thời HA dương tính thì trong bệnh phẩm có virus (cũng gây ngưng kết hồng cầu) nhưng không phải Niu cát xơn. Có thể làm phản ứng HI với kháng huyết thanh chuẩn của một số virus khác (Cúm, EDS...) để xác định nguyên nhân bệnh.

 

Phụ lục F

(Quy định)

Phương pháp xác định chỉ số độc lực trên não gà con

Chủng Virus phân lập (nước trứng) được pha nồng độ 1 : 10 trong dung dịch PBS pH từ 7,0 đến 7,4 rồi tiêm vào não 10 gà con 1 ngày tuổi, với liều 0,05 ml/con.

Gà được theo dõi trong 8 ngày liền, ghi lại những biểu hiện sức khỏe.

Biểu hiện bệnh được tính bằng điểm:

- Bình thường: 0 điểm

- Ốm: 1 điểm

- Chết: 2 điểm (các ngày còn lại sau khi chết được chấm 2 điểm)

Ví dụ thí nghiệm có kết quả theo dõi như trong bảng dưới đây:

Gà số

Ngày sau công virus Niu cát xơn

Tổng số điểm

ICPI

1

2

3

4

5

6

7

8

1

0

1

2

2

2

2

2

2

13

1,625

2

1

1

2

2

2

2

2

2

14

1,75

3

0

0

2

2

2

2

2

2

12

1,5

4

0

2

2

2

2

2

2

2

14

1,75

5

2

2

2

2

2

2

2

2

16

2

6

2

2

2

2

2

2

2

2

16

2

7

2

2

2

2

2

2

2

2

16

2

8

1

2

2

2

2

2

2

2

15

1,875

9

0

2

2

2

2

2

2

2

14

1,75

10

1

2

2

2

2

2

2

2

15

1,875

Tng hợp

145

1,813

Chỉ số ICPI đối với mỗi gà thí nghiệm là số điểm trung bình của gà đó sau 8 ngày theo dõi. Điểm trung bình của cả lô thí nghiệm (10 gà) là chỉ số ICPI của virus Niu cát xơn được dùng. Theo OIE, nhóm Lentogenic có ICPI xấp x 0. Nếu ch số ICPI ³ 0,7 thì virus Niu cát xơn phân lập được coi là có độc lực gây ra dịch. Các nhóm virus có độc lực càng cao sẽ có chỉ số ICPI càng gần giá trị 2,0.

 

THƯ MỤC TÀI LIỆU THAM KHẢO

[1] Bộ Nông nghiệp và Phát triển nông thôn - Cục Thú y, 2006. Tiêu chuẩn, quy trình ngành thú y, Quy trình chẩn đoán bệnh Newcatsle/10 TCN 719-2006, trang 221-234.

[2] O.I.E., 2009. Manual of Diagnostic Tests and Vaccines for Terrestrial Animals, Newcastle disease, chapter 2.3.14.

[3] Bộ Nông nghiệp và Phát triển nông thôn - Viện Thú y quốc gia 2002. (2002). Cẩm nang chẩn đoán tiêu chuẩn về các bệnh gia súc ở Việt Nam, in lần thứ nhất, Bệnh New cát xơn, trang 172-173.

Tiêu chuẩn Việt Nam
Tiêu chuẩn Quốc gia TCVN 8400-4:2010 Bệnh động vật-Quy trình chẩn đoán-Phần 4: Bệnh Niu cát xơn
Số hiệu: TCVN 8400-4:2010 Loại Văn bản: Tiêu chuẩn Việt Nam
Cơ quan ban hành: Bộ Khoa học và Công nghệ Lĩnh vực: Nông nghiệp-Lâm nghiệp
Năm ban hành 2010 Hiệu lực:
Người ký: Tình trạng hiệu lực: Đã biết
Vui lòng đăng nhập tài khoản gói Tiêu chuẩn hoặc Nâng cao để xem VB liên quan.
Nếu chưa có tài khoản Quý khách đăng ký tại đây!
* Lưu ý: Để đọc được văn bản tải trên Luatvietnam.vn, bạn cần cài phần mềm đọc file DOC, DOCX và phần mềm đọc file PDF.
Để được giải đáp thắc mắc, vui lòng gọi
1900.6192 hoặc gửi câu hỏi tại đây

Tải ứng dụng LuatVietnam Miễn phí trên

Văn bản cùng lĩnh vực